Review



ervin welker  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc ervin welker
    Ervin Welker, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/B-SpCas9-HF1+(Plasmid+%23126762)/pm41896269-176-42-44
    Average 91 stars, based on 3 article reviews
    ervin welker - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Applications of recombined ScCas9 enzymes for PAM-free DNA modification
    Article Snippet: To generate SpRYc, the N-terminal ORF of Sc++ (Addgene Plasmid #155011), corresponding to residues (1-1119) was PCR amplified and assembled using Gibson Assembly into the pCMV-T7-SpRY-P2A-EGFP backbone (Addgene Plasmid #139989), preserving residues 1111-1368 of SpRY's ORF. pCMV-T7-SpCas9-P2A-EGFP (Addgene Plasmid #139987) was used for SpCas9, and Sc++ was similarly integrated within the backbone. .. Analogously, the ORFs of SpCas9, SpRY, and SpRYc were integrated within the ABE8e (Addgene Plasmid #138489) and AncBE4Max (Addgene Plasmid #112094) backbones. sgRNA plasmids were constructed by annealing oligonucleotides coding for crRNA sequences (Tables 1 and 2) as well as 4 bp overhangs, and subsequently performing a T4 DNA Ligase-mediated ligation reaction into a plasmid backbone immediately downstream of the human U6 promoter sequence. ..

    Article Title: The Protein Tyrosine Phosphatase CD45 promotes PMN Transepithelial Migration, Antimicrobial Function and Colonic Mucosal Repair
    Article Snippet: .. The SpCas9 of lentiCRISPR V2 (Addgene plasmid # 52961) was modified to generate a plasmid containing the high fidelity eSpCas9 1.1 ( ) termed lentiCRISPR eSpCAS9. ..

    Article Title: mRNA-engineered CRISPR-Cas epigenetic editors enable durable and efficient gene silencing in vivo
    Article Snippet: .. The mammalian expression plasmid for the initial SpCas9-OFF-EE V1 was obtained from Addgene (Addgene, #167981). ..

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Article Title: Compositions for use in treating autosomal dominant BEST1-related retinopathies
    Article Snippet: .. In addition, the px458 plasmid carrying the sgRNA 581G-17nt sequence (SEQ ID NO: 13) expresses both, the SpCas9 and the red fluorescent protein mcherry (Addgene #64324), while the px458 plasmid carrying sgRNA 749A-20nt (SEQ ID NO: 55) expresses the SpCas9 as well as the green fluorescent protein GFP (Addgene #48138). ..

    Construct:

    Article Title: Applications of recombined ScCas9 enzymes for PAM-free DNA modification
    Article Snippet: To generate SpRYc, the N-terminal ORF of Sc++ (Addgene Plasmid #155011), corresponding to residues (1-1119) was PCR amplified and assembled using Gibson Assembly into the pCMV-T7-SpRY-P2A-EGFP backbone (Addgene Plasmid #139989), preserving residues 1111-1368 of SpRY's ORF. pCMV-T7-SpCas9-P2A-EGFP (Addgene Plasmid #139987) was used for SpCas9, and Sc++ was similarly integrated within the backbone. .. Analogously, the ORFs of SpCas9, SpRY, and SpRYc were integrated within the ABE8e (Addgene Plasmid #138489) and AncBE4Max (Addgene Plasmid #112094) backbones. sgRNA plasmids were constructed by annealing oligonucleotides coding for crRNA sequences (Tables 1 and 2) as well as 4 bp overhangs, and subsequently performing a T4 DNA Ligase-mediated ligation reaction into a plasmid backbone immediately downstream of the human U6 promoter sequence. ..

    Ligation:

    Article Title: Applications of recombined ScCas9 enzymes for PAM-free DNA modification
    Article Snippet: To generate SpRYc, the N-terminal ORF of Sc++ (Addgene Plasmid #155011), corresponding to residues (1-1119) was PCR amplified and assembled using Gibson Assembly into the pCMV-T7-SpRY-P2A-EGFP backbone (Addgene Plasmid #139989), preserving residues 1111-1368 of SpRY's ORF. pCMV-T7-SpCas9-P2A-EGFP (Addgene Plasmid #139987) was used for SpCas9, and Sc++ was similarly integrated within the backbone. .. Analogously, the ORFs of SpCas9, SpRY, and SpRYc were integrated within the ABE8e (Addgene Plasmid #138489) and AncBE4Max (Addgene Plasmid #112094) backbones. sgRNA plasmids were constructed by annealing oligonucleotides coding for crRNA sequences (Tables 1 and 2) as well as 4 bp overhangs, and subsequently performing a T4 DNA Ligase-mediated ligation reaction into a plasmid backbone immediately downstream of the human U6 promoter sequence. ..

    Sequencing:

    Article Title: Applications of recombined ScCas9 enzymes for PAM-free DNA modification
    Article Snippet: To generate SpRYc, the N-terminal ORF of Sc++ (Addgene Plasmid #155011), corresponding to residues (1-1119) was PCR amplified and assembled using Gibson Assembly into the pCMV-T7-SpRY-P2A-EGFP backbone (Addgene Plasmid #139989), preserving residues 1111-1368 of SpRY's ORF. pCMV-T7-SpCas9-P2A-EGFP (Addgene Plasmid #139987) was used for SpCas9, and Sc++ was similarly integrated within the backbone. .. Analogously, the ORFs of SpCas9, SpRY, and SpRYc were integrated within the ABE8e (Addgene Plasmid #138489) and AncBE4Max (Addgene Plasmid #112094) backbones. sgRNA plasmids were constructed by annealing oligonucleotides coding for crRNA sequences (Tables 1 and 2) as well as 4 bp overhangs, and subsequently performing a T4 DNA Ligase-mediated ligation reaction into a plasmid backbone immediately downstream of the human U6 promoter sequence. ..

    Article Title: Compositions for use in treating autosomal dominant BEST1-related retinopathies
    Article Snippet: .. In addition, the px458 plasmid carrying the sgRNA 581G-17nt sequence (SEQ ID NO: 13) expresses both, the SpCas9 and the red fluorescent protein mcherry (Addgene #64324), while the px458 plasmid carrying sgRNA 749A-20nt (SEQ ID NO: 55) expresses the SpCas9 as well as the green fluorescent protein GFP (Addgene #48138). ..

    Modification:

    Article Title: The Protein Tyrosine Phosphatase CD45 promotes PMN Transepithelial Migration, Antimicrobial Function and Colonic Mucosal Repair
    Article Snippet: .. The SpCas9 of lentiCRISPR V2 (Addgene plasmid # 52961) was modified to generate a plasmid containing the high fidelity eSpCas9 1.1 ( ) termed lentiCRISPR eSpCAS9. ..

    Clone Assay:

    Article Title: Single-molecule dynamics of the TRiC chaperonin system in vivo.
    Article Snippet: .. A CCT4 specific single guide RNA (sgRNA) (ATCTCTAAGATCTACACTGG) was cloned into the pSpCas9(BB)-2A-Puro (PX459) vector, which encodes SpCas9 and puromycin resistance57 (Addgene #48139). ..

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Expressing:

    Article Title: mRNA-engineered CRISPR-Cas epigenetic editors enable durable and efficient gene silencing in vivo
    Article Snippet: .. The mammalian expression plasmid for the initial SpCas9-OFF-EE V1 was obtained from Addgene (Addgene, #167981). ..

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Stable Transfection:

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Generated:

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Transduction:

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.

    Selection:

    Article Title: The BRCA1-A complex restricts replication fork reversal-dependent DNA repair in ATM deficient cells
    Article Snippet: .. For SpCas9, stable cell lines expressing SpCas9 were first generated by lentiviral transduction with lenti-SpCas9 hygro (Addgene, plasmid #104995), and subsequent selection with hygromycin (500 μg/ml). sgRNA guides were cloned into either lentiGuide-Puro (Addgene, plasmid #52963) or lentiGuide-neo (U6-sgRNA-P2A-Neo, reconstructed from Addgene plasmid #52963) vector digested with BsmBI-v2 (New England Biolabs) following the protocol described previously . sgRNA plasmids (2.7 μg) were packaged into lentivirus particles by co-transfecting with packaging plasmids psPAX2 (2 μg, Addgene, plasmid #12260) and pMD2.G (1.3 μg, Addgene, plasmid #12259) into HEK293T cells grown in a 6-well plate using lipofectamine 2000 (Invitrogen). .. Lentivirus supernatant was collected 48 h post-transfection, filtered through a 0.45-μm filter (Millipore) and subsequently used to transduce the target cells using polybrene (8 μg/ml, Sigma-Aldrich) by spin infection at 2000 rpm for 90 min.



    Similar Products

    93
    Integrated DNA Technologies snls-spcas9-snls nuclease
    Snls Spcas9 Snls Nuclease, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/sNLS-SpCas9-sNLS+Nuclease/custom%4010017687%4010%2E1016%2Fj%2Eomton%2E2026%2E201206
    Average 93 stars, based on 1 article reviews
    snls-spcas9-snls nuclease - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    86
    Synthego Inc spcas9 protein
    Spcas9 Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/analysis+crispr+ice+tool/pm42320470-695-23-25
    Average 86 stars, based on 1 article reviews
    spcas9 protein - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    Integrated DNA Technologies alt-r s.p. cas9 v3, glycerol-free
    Alt R S.P. Cas9 V3, Glycerol Free, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/Alt-R+S%2Ep%2E+Cas9+V3%2C+glycerol-free/custom%4010007806%4010%2E1016%2Fj%2Escr%2E2026%2E104040
    Average 96 stars, based on 1 article reviews
    alt-r s.p. cas9 v3, glycerol-free - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Synthego Inc design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing
    Design Optimization Crispr Cas Spcas9 Guide Rna Ggacagaaugaugaaccugg Editing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/analysis+crispr+ice+tool/pm42269214-46-7-18
    Average 86 stars, based on 1 article reviews
    design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc spcas9
    Spcas9, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/analysis+crispr+ice+tool/pm42127894-323-20-21
    Average 86 stars, based on 1 article reviews
    spcas9 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc spcas9 2nls nuclease
    Spcas9 2nls Nuclease, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/analysis+crispr+ice+tool/pmc13133607-87-39-45
    Average 86 stars, based on 1 article reviews
    spcas9 2nls nuclease - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc spcas9 nuclease protein
    Spcas9 Nuclease Protein, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/analysis+crispr+ice+tool/pmc13126711-31-39-43
    Average 86 stars, based on 1 article reviews
    spcas9 nuclease protein - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc ervin welker
    Ervin Welker, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spcas9/B-SpCas9-HF1+(Plasmid+%23126762)/pm41896269-176-42-44
    Average 91 stars, based on 1 article reviews
    ervin welker - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results